Separation of the 8 major molecular types of the C. neoformans complex via URA5-RFLP analysis
S. Jackson & W. Meyer
PCR-RFLP analysis of the URA5 gene:
The URA5 gene was amplified in 50 m l, containing: 50 ng DNA, 1 x PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2), 0.2 mM each of dATP, dCTP, dGTP, and dTTP, 3 mM MgAc, 1.5 units AmpliTaq DNA polymerase, and 50 ng of each of the primers: ura5f (5' ATGTCCTCCCAAGCCCTCGACTCCG 3') and ura5r (5'TTAAGACCTCTGAACACCGTACTC 3'), using the following program: 1 cycle of 94° C for 3 min., 35 cycles of 94° C for 45 sec., 61° C for 1 min., and 72° C for 2 min., followed by 1 cycle of 72° C for 10 min. PCR products were digested with Sau96I and HhaI for 3 hours or overnight and separated by 3% agarose gel electrophoresis at 100V for 5 hours.
Figure: (URA5 gene RFLP profiles identified via double digestion with Sau96I and HhaI obtained from the reference strains of the major C. neoformans molecular types.
Reference:
Meyer W, Castaneda A, Jackson S, Huynh M, Castaneda E and the IberoAmerican Cryptococcal Study Group (2003): Molecular typing of IberoAmerican Cryptococcus neoformans Isolates, Emerging Infect. Dis.: 9(2):189-195. 44